Mildly Diverting

New Romances of the Body

Television and the Somatics of Technology

Kim Plowright, January 1999

Contents

• One
• New Romances of the Body: Television and the Somatics of Technology
• Two
• Production Analysis
• Three
• Bibliography
• Appendix
• Budgets
• Production Documentation
• Pitches
• Correspondence
• Permission Forms
• Footnotes

One

New Romances of the Body: Television and the Somatics of Technology

Soul: O! who shall from this dungeon raise
a soul inslav'd so many wayes?
With bolts of Bones, that fetter'd stands
In feet; and manacled in hands.
Here blinded with an eye; and there
Deaf with the drumming of an ear
A soul hung up as t'were in chains
Of Nerves and arteries and Veins.
Tortur'd besides each other part
in vain Head and double Heart

Andrew Marvell (Sawday 1996 p 20)

The lived experience of the body in the (very) late twentieth century is circumscribed by a particular kind of awareness of the theory constructed around it. This is by no means a new phenomenon, but is perhaps now more marked by the multiplicity of discourses that have focused on the substance of the human being. Anorexia and body image are just fodder for chat shows, fashion magazines congratulate themselves on using disabled bodies to show off their clothes. Medicine seems to be failing in the face of new and untreatable conditions such as CJD and Epstein-Barr, with more and more people turning to complementary therapy to deal with their newly developed allergies, asthma or IBS. Sporting circles are pushing the limits of human physical ability whilst condemning the augmentation of nature with drugs. Everyone has a piercing, these days… (Showalter, 1998; Kroker and Kroker, 1987)

The texture of modern life seems to be changing in a way that privileges the understanding of the body as a cultural phenomenon, whilst simultaneously acknowledging the frailties and failings of the somatic mechanism that enables our 'self' to perceive and act upon the world around it. This is by no means a process of deliberate change, but a subtle epistemological shift reliant on the feedback mechanism between theory and exemplar. However, I believe that the rate of change of the zeitgeist, if you will, has been increased by the dissemination of ideas through the mass media, and television in particular. Information culture is impacting on the way we live our everyday lives, and also the way we conceptualise the world around us through the permeation of media into all aspects of society, and the consequential acceleration of the rate of dissemination of ideas. To borrow an evolutionary metaphor, the selective pressure on our Memes is greater now than it ever has been.[1]

This neo-Darwinian analogy is not quite as far fetched as it seems. Whilst this discussion is to some extent concerned with the genealogy of knowledge, it is primarily about the relationship between flesh and information. Taking the graphic language of the recent series 'The Human Body' as an example, I intend to examine the way that television constructs images of the inside of the body, and the way this affect the viewer. The advance of imaging techniques, computer technology and special effects has led to the increasing visual sophistication of the viewer, and television's increasing self-referentiality produces a greater awareness of the construction of mediated discourse in its audience. By looking at the use of mechanical systems to augment natural vision, and the way the body can become coded digitally, I then propose to examine the slightly uneasy relationship between the lived body and virtual space, where ideal forms work to sublimate unease at the 'animal' aspects of the body. Finally, I would like to show the way in which anxieties about technological change are written onto the body in terms of disgust and the 'abject', that is to say to bodily effluvia as a token of the 'other'.

Envisioning the Body

'In the anatomy theatres the body was not only demonstrated but performed; it became transformed into a universalised sign reflecting back upon each viewer as the uncanny unveiling of their own insides, of a universal, humanistic corporeal condition'

(Thacker, 1998)

Why are we interested in investigating our physical bodies? I suspect that, biology and science aside, there is a fundamental fascination in the body as the universal feature that all humanity shares in common. The western christian tradition particularly encourages this by its central concept of the Word made Flesh: that the human body displays its divine origins, is made in the image of God; and through its use of images of bodily mortification and consumption to unite its adherents. However, I feel that in a secular world the important aspect of this investigation is the search for self: looking in to your interior to discover that thing that makes you what you are, that marks you out as an individual. This can be traced back to the Anatomy theatres of the Renaissance, with their motto above the door: Nosce te ipsum - 'know thyself'. (Petherbridge, 1998)

While this phrase still has connotations for current notions of self-discovery through therapy and self examination, the body that it refers to has changed a great deal. It is helpful, then, to examine the way that the idea of the body has been constructed by various discourses. First by applying Foucault's concept of Archaeology - the underlying assumptions and impersonal structures beneath knowledge - I want to show how vision and the gaze has had a primary effect in developing new ways of understanding the body. I then want to relate Foucault's ideas to another conceptual structure using technological advance as an organising principle, as set out by Norbert Wiener.

Foucault's Archaeologies

'There is nothing more tentative, nothing more empirical (superficially, at least) than the process of establishing an order among things; nothing that demands a sharper eye or a surer, better-articulated language; nothing that demands that one allows oneself to be carried along by the proliferation of qualities and forms. And yet an eye not consciously prepared might group together certain similar figures and distinguish between others on the basis of such and such a difference: in fact, there is no similitude and no distinction even for the wholly untrained perception, that is not the result of a precise operation and of the application of a preliminary criterion'

(Foucault, 1970 p xix)

The idea of the shift in the underlying organisational structures of knowledge runs throughout much of Foucault's writing. The epistemological theories set forth in 'the order of things' ( essentially a study of the way man has become the object of knowledge) are possibly the most significant articulation of this. The above quote illustrates the assumption underlying the theory: that no matter how objective (or ingenuous) the observer tries to be in ordering the world into categories of knowledge, there will always be assumptions a priori which will effect the eventual categorisations. This implies that our thought processes are almost a product of the society in which we live: the process of enculturation deeply imprints certain assumptions about the classification of the world which are only seen as spurious in retrospect, once those ideas no longer have currency. It is an adaptation of the idea of paradigms, but allows for the shifting from one mode of thought to the next. Foucault breaks down knowledge into three distinct discontinuous epistemes: Renaissance Classical and Modern.

The Renaissance episteme relies on similitude and affinities: that is to say, the likeness of things. These likenesses fall into several categories depending on how the relationship functions: by similarities in physical disposition, by being contiguous in the 'chain of being', by attraction to one another and so on. These relationships were fixed, and could be discovered by reading the external signs of things; the world is reduced to a system of ideograms, legends, waiting to be read by someone with enough insight to uncover the occult symbolism placed there during the act of divine creation. The world was literally the word made flesh: knowledge was a process of reading, understanding the body was haruspection. Knowledge was divinatio: the inspirational breath of God. in understanding the world one had to engage in divining sacred knowledge by following chains of resemblance from one object to another in what was ultimately a closed system based on interpretation.

The Classical episteme marked the beginning of the rational project: systems of occult significance gave way to careful observation and measurement as the basis of the system of knowing the world. The project of taxinomia - classification - privileged the differences between things as the basis for their placing in the overall system of knowledge. This system of classification was supplemented with mathesis, a universal, scientific system of measurement based on accepted norms. The existence of an objective, empirical truth thus becomes possible as it becomes possible to consider the subject of examination as a discrete object, having its own particular set of relations to a system of homologies, but a unique set of co-ordinates within the tabula of the system.

'The principle of classification is [ ] to determine the character that groups individuals and species into more general units that distinguishes those units from one another and that enables them to fit together to form a table in which all individuals and all groups, known or unknown will have their appropriate place.'

(Foucault, 1970 p266)

However, this tabulation of knowledge presumes a detached viewer in the shape of man, who occupies a privileged position outside the classificatory system

Man is included in the order of things in the Modern episteme. The modern episteme has as its organising principle a similar taxonomic project, but one that is not based on the viewable attributes of things, but through divining the origins of the similarity of things in their function. Homology is overtaken by homogenity. This introduces the concept of history as a traceable thread in the relation of things; a kind of organisational grand narrative. It relates the visible to the invisible in that by relating the appearances of something to that which you know of its history, you are able to fit it into a classificatory system on the basis of its structural organisation, rather than of a structural organisation imposed upon it from outside. Thing determine their own place in the system through attributes such as their level of complexity. The organising histories of this episteme allow that man is part of nature and thus can be studied. Man is within the realm of knowledge, but also occupies a transcendental position as the subject of discourse.

So, how is the body conceptualised within each of these epistemes? The Renaissance marked the beginning of the investigation of the body as we know it through dissection and anatomy The features they found within the body were related to other aspects of the observable world - the circulation of blood was likened to the air and rain circulating in the heavens. The body was also read as a metaphor for the state, with relics of this belief surviving today in the form of idiomatic phrases: the head of state and the body politic. This Galenic/Vesalian body was a primarily geographical entity, a microcosm of the macrocsmic world which the barber surgeons discovered as if they were conquering a new territory. The signs of the body are being read and translated into a system of analogous similitude. Here is Walter Charleston, an English anatomist

'There are yet, alas! Terrae incognitae in the lesser world, as well as the greater, the Island of the Brain, the Isthmus of the Spleen, the streights of the Renes and �some other glanduls, the North-East passage of the drink from the Stomach to the Kidnies and many other things remain to be further enquir'd into by us, and perhaps by posterity also.'

(Sawday 1996, p28)

The process of dissection involved a literal reading into the body, as it was normal for the anatomist carrying out the dissection to read a commentary from a book to illustrate the cadaver he was displaying. The words would gloss the body, invest it with meaning, and illustrations could be mapped on to the body in order to see what should be there. The Neo-platonic beliefs that held sway suggested that everything had its ideal form, and the schematised illustrations helped this ideal form be imprinted onto the indefinite flesh beneath. In return the body would reveal its secrets, and speak of its occult correspondences

The body was also suffused with the discourse of the Church, the primary organisational force within society. Religious imagery of saintly mortification contributed to a body that was visceral, that suffered, was fallen and sinful, with belief being inscribed on to the lived experience of the body through ritual and dogma. (Mellor/Shilling 1997) The church encouraged a form of sensual knowledge and apprehension through the body, rather than emphasising written or spoken liturgy. Unbaptised bodies bore evil in their flesh, and baptism was seen as transforming the body into the flesh and bone of Christ in a process of transubstantiation. Sin had to be driven out from the body in fearsome rituals of flagellation. One of the most extreme instances was of St Catherine of Sienna, who drank pus from the sores of the sick in her care (Miller, 98 p 158). Above all of this familiarity with the horrific was the overriding tenet of reincarnation. The dead were believed to rise up at the last day quite literally, and consequently being dismembered after death was a severe form of punishment: it ruptured the corpses' integrity and prevented it being reanimated at the last judgement. Even in life, flesh itself was never far from decay, worms being believed to live within the body's liquors, multiplying during sickness and death. (Mellor/Shilling 1997)

The body of the classical episteme is the Harveian body of enlightenment enquiry. After the Cartesian formulation the idea of the body as a hidden continent was discredited, and the body began to be rationalised as a mechanism, a machine for living in. Descartes' (himself an anatomist) famous splitting of the conscious being from a diffuse embodiment to a product of the mind in cogito ergo sum lead to an approach that saw the body as a housing for the all important mind, which was not truly present in the flesh of the cadaver.

'More than this, however, the body as a machine, as a clock, as an automaton, was understood as having no intellect of its own. Instead, it silently operated according to the laws of mechanics. We move then from an interior in which the body seems to speak its own part, to the modern conception of a physiological system no more capable of speech than is a hydraulic pump - the machine which Harvey himself had sought to explain the operation of cardiac valves.'

(Sawday 1996 p29)

This new division between flesh and mind is illustrated in Rembrandt's 'The Anatomy Lesson of Dr Nicholas Tulp' painted in 1632, which depicts an anatomist gesturing with one hand whilst forcing the hand of a cadaver to reproduce the gesture by pulling the tendons of the arm. One consciousness is willing two bodies to move, and thus must be separate from, and have power over, the physical body and also over death. (Sawday, 1996)

The growing 17^th century universities built Anatomy theatres in great numbers: large, circular auditoria where dissection was presented as a public spectacle. Here, the body was put on display and elucidated for an audience: it had become the object of scientific and public regard. Anatomies were linked with assizes, the bodies being those of condemned criminals, hence the body is further implicated as a site of the exercising of state power. (Petherbridge, 1998) What was stripped away from it in the Cartesian project was the dense oversignificance of it. The irrational aspects of the renaissance body - and the sensuality that this brought about were negated in the face of the bright light of reason. The body is no longer a metaphorical country, or a map of state power, but an object of scientific regard that is measurable and classifiable. The myth has been stripped out of its natural history, and its parts named according to their disposition within the larger system of the body as a whole. (Foucault, 1970)

The modern body is a body situated within the grand narratives of biology, as well as the human sciences. Taking itself as both subject and object of knowledge has split it profoundly. At one extreme we have the somatic body of Biology and evolution: an organic system that is somehow progressing towards perfection, driven by an unthinking language of genetics. At the other we have the body of the human sciences, and particularly that of psychoanalysis, which has been swallowed into the mind in its entirety, with even bodily sensation being mapped on to cognitive and linguistic functions. Foucault's empirico-transcendental doublet can be likened to Durkheim's concept of Homo Duplex: the embodied man who must suppress the natural, uncouth aspects of his body in order to present a civilised appearance to the world. (Mellor/Shilling, 1997) This allows us to question the absolute control implicit in the enlightenment project of understanding the body. A space opens up in thinking for the irrational, sensual and visceral, but these unstable categories are then carefully reburied in discourse around the subconscious mind.

The differences between the three epistemes could also be simply delineated in their relation to the look at the body, and to vision.

'Scientific notions of "objectivity" and the prevalence of surveillance in modern societies reflect what has been called the "scopic regime" of modernity. This regime expresses not just the tendency to locate sight at the top of the sensual hierarchy but also the colonisation of the visual by the cognitive through what Cascardi calls "the fiction of the subject as a sovereign observer or judge"'

(Mellor/Shilling, 1997, p155)

This visual privilege can be read as a product of the modern episteme, deriving from the enlightenment idea that the eyes are the most direct method of cognition: seeing is believing. In the Birth of the Clinic Foucault examines the birth of modern medicine, uncovering an archaeology of clinical practice based on the visual perception of the body. From looking at the external effects of illness in the renaissance and relating them to manifestations of, say, a particular personality trait such as melancholy, classical medicine moves towards a system of speciation of symptoms. Thus all fevers are linked into a tabular hierarchy of fevers, which are themselves the illness and act upon the body. The modern episteme then sites these symptoms back within the body itself, as reactions by the substance of the body to external agents. The renaissance doctor is surveying the body for its outward signs that give away its position in relation to thought-structures: a choleric face, a sanguine disposition , in a process of seeing similarities. The eye in Classical medicine is trained to look for discrete differences, unique occurrences that identify the disease by the signs it is leaving in the spatial body. by looking and comprehending, the physician is giving form to disease which is subject to his gaze.

In modern medicine the eye alone is no longer enough to see the subtle and diffuse play of lesions within the body that indicate the presence of disease. As medical discourse becomes concerned with recognition of disease in its early stages for ease of cure, and with prophylaxis, it becomes necessary to find ways of looking into the body to find the lesions hidden within its internal, secretive structure. Consequently, vision in the modern age acquires prostheses: sense extensions. The earliest of these is the microscope, a prosthesis of sight through scale, allowing the perception of structure on a finer and finer scale, and so a greater appreciation of the complexity of life. Other senses are prosthetised when it is realised that senses such as touch and hearing can also reveal information about the patient. The stethoscope is an obvious example of the way non-visual sensory information is used to effectively see into the living body without harming it. (Foucault 1973)

The development of technology has enabled the development of increasingly sophisticated sensory prosthesis. What started out with percussion of the thoracic cavity has metamorphosed into Magnetic resonance Imaging, ultrasound, the X-ray, Computerised tomography, cryosectional mapping and the many other wonders of technology that give us an insight into the disposition of the flesh. (Cartwright, 1995)

Wiener's Epistemology of Automata

If Foucault gives us the understanding that changing patterns of knowledge, and visual perception help organise the somatic experience of living, then Norbert Wiener, the father of modern cybernetics, has proposed a further corollary on the changing pattern of somatic knowledge in the form of technological conceptualisations of automata. His ideas are laid out in similar timeframes to Foucault's epistemes.

Each age also maps its mechanical axiom onto its understanding of the somatic structure of the body. So, the Golem body is a magical clay figure, animated by mysterious forces. The Clockwork body is a system of intricate mechanisms meshing together into a whole. The Steam driven body is engineered, burning fuel and having a governor to keep it within healthy parameters. The parallels between Foucault's and Wieners systems are obvious. (Featherstone/Burrows, 1995)

However, Wiener took his theory a step further, proposing a new age of Communication and Control, of machine speaking to machine: an interdisciplinary science of cybernetics. The automata of this age are distinguishable by the servomechanism, an input output device which monitors the surroundings and adjusts the functioning of the machine accordingly. Wieners cybernetic automaton was conceived as an:-

'Active, hierarchically governed, self regulated and goal oriented machine, which was bound through with a particular time/space logic - the adjustment of future conduct through a comparative assessment of past actions - to its environment.'

(Featherstone/Burrows, 1995 p 25)

It is easy to see how life and the body can be inscribed with this theory: the body becomes a complex of systems co-ordinated by a central regulatory system in the shape of the CNS. Its input and output lie in the senses and language, and its adjustment of future conduct can be imagined not only on the level of comprehension and learning, but also at a deep somatic level of evolution through genetic 'learning' (natural selection). The cybernetic body even has its own programming language: GATTACAGGTACCCATGAAGCA…

'The cybernetic approach is centrally concerned with this unavoidable limit of what we can know: our own subjectivity. In this way cybernetics is aptly called 'applied epistemology'. At minimum, its utility is the production of useful descriptions, and specifically, descriptions that include the observer in the description'

(Pangaro 1998)

It would be easy to think of this Cybernetic episteme as contiguous with Foucault's Modern Episteme due to the prioritisation of the nervous system and senses as the organising principle of man, and the concern with subjectivity. However, there is something more to it, in that it allows for the first time the inorganic to impinge on what the modern episteme would see as the exclusive realm of life and consciousness. The category 'Body' becomes problematised as it becomes possible to augment it with inorganic, synthetic machine based elements, and machines become more recognisably 'bodylike' and organic in their operation. 'Cogito' as the body's counterpart is also subject to reassessment, as the possibility of containing a human consciousness within a mechanical apparatus is contrasted with the production of pure machine AI. The body's position as a buffer between the separate realms of nature and culture is blurred. Cybernetic theories seem to mark the start of the post-human condition, and to fall into what we may in future think of as the Post-modern episteme: one of interdisciplinary investigation, diffuse systems of viewing, a breakdown in systems of categorisation and an increasing hybridity in many aspects of cultural formation.

The Visual Presence of the Body on Television

'Reality is not the objectivity of empiricism, but a product of discourse'

(Fiske, in Curran/Guerivitch 1991 p56)

The point of intersection between Foucault's and Wiener's genealogies is mechanical imaging of the body: sensory prosthesis. Ironically, one of the earliest forms of medico-technological prosthesis, the X-ray tube, is a very similar artefact to the cathode ray tube, the basis of television. I believe that television itself is a form of prosthesis, the camera standing in for the viewer's eye and the whole mechanism of broadcast becoming a kind of mechanism for gathering knowledge of the world outside the viewers immediate experience. The all-enveloping search for new information to present to the viewer has meant that the modern medical prostheses of viewing have been integrated into the visual/cognitive-prosthesis of television, in a way that dissolves the body within a technological matrix. Data about the subject can be gathered using specialist cameras and imaging techniques, and subsequently re-encoded as signs within a symbolic system of editing, computer graphics and visual effects. This 'real' data is received by the viewer who then processes that information in terms of their experience, which can lead to an understanding of their own body in terms of these disembodied images, bearing little relationship to the somatic body. The relation of vision and understanding has changed: rather than the gaze exposing the truths of things or being the one reliable way of finding that truth, the gaze is now mechanically altered to form images of the world that reflect what we understand about it. Vision is no longer objective as we move into the realm of virtuality. (Featherstone/Burrows, 1995) The lived reality of the body of the cybernetic episteme is beginning to emerge through the television screen.

The most striking, (and groundbreaking) use of this idiom recently was the BBC's series The Human Body (TX May/June 98). It transmitted in a flurry of publicity about its epic scale, enormous cost, the two and a half years it took to complete and not least the fact that it showed an 'actual death' for the first time. The series itself was very carefully constructed, aware of its status as an authoritative voice, and closely engaged with theoretical constructs of the body that are current in medical and scientific circles. Based around the idea of change and time, each programme was devoted to a particular part of the life-cycle in the 'seven ages of man'. Opening with a flurry of statistics designed more to amaze than inform, the sense of awe in the face of this complex and mysterious body never really disappeared: we have gone beyond the limits of the rational project of science, and were reminded of this by the expert presenter, Sir Robert Winston, stressing all of the things that science can't tell us as much as the known facts.. 'Life' was portrayed as a miracle: both biological in the sense of the unknown functions of the body, and statistical, in that there is so much that can go wrong with the delicate balance of life, but never does. The programme was aware of treating the body in a new way, avoiding the systemic, mechanistic approach and instead relating the body to lived experience.

'We moved away from the idea of systems such as circulation and the nervous system… many previous works have treated the body like a biological machine. In fact, it is so integrated that it doesn't really have separate parts. There's also a vast human side untouched by just looking at the biology. We needed voices of equal weight to describe, for example, how it feels to be pregnant and this is as important as what is actually going on'

(Ariel, 19/5/98)

The selling point of the series was its lavish use of visuals. Many sequences were based on new techniques not before used in broadcast television, but familiar to medical professionals. The most notable of these was the use of magnetic resonance imaging: a kind of density measurement, to scan thin sections of the body. The data from these was then 'cleaned' to simplify it, removing confusing detail, and the sections stacked to produce a three dimensional model. This enabled the computer animations to 'fly' inside the body as if the tissue were insubstantial, seeing the body from within its own solidity. The problem of not being able to see the interior of the live body except through secondary senses such as hearing is solved by converting abstract 'sensed' data into a schematised visual model. However, the images are heavily mediated, with the knowledge of what should be seen there deciding which sections were re-presented through graphic manipulation.

'To make them work we had to find a way of paring away extraneous detail… We spent a year writing a computer programme to do that. What we were trying to achieve was a magic camera that can see things that we cannot'

(Interview with Richard Dale, 22/5/98 The Times)

What they are trying to achieve is a way of reducing reality to accepted signs, a visual ellipsis of knowledge and reality. Cognition is forming the body to its own perceptual pattern. Attention was rarely drawn to these techniques during the main narrative of the programme: instead they were described in a special 'making of' programme shown as a coda to the series. Perhaps knowing about the manipulations the images had undergone before seeing them would have broken the narrative flow by removing the air of authenticity from them: even in the explicit discussion of the special effects the stress was always placed on the fact the images were based on real information, and not mere computer models. A number of newspaper reports picked up on this at the time, questioning the way we now have to suspend our disbelief during factual programmes: we have become numbed to reality by the Hollywood blockbuster that can recreate anything from scratch.

'So were we shown the process just because it is now possible to do so? [ …] Those special effects tricks created by Hollywood have also dulled our senses: it is hardly Winston's fault, but it takes a lot to astonish us nowadays.'

(The Times, 28/5/98)

'The Prof was especially delighted with footage that purported to show a neuron inside a brain firing one of the electrical impulses that enable us to think. Of course, if this was merely a computer-generated special effect, I doubt whether any of us would have been able to tell the difference'

(The Guardian, 18/6/98)

'Examples include a brain cell firing and the moment of ovulation: scenes which the viewer may imagine they have seen before What they've actually seen in the past are simulations - the best guess that computer graphics could make. The Human Body offers the viewer a chance to see the real thing.'

(Ariel, 19/5/98)

Authenticity is supremely important. However, 'real' natural data is only truly meaningful if it is filtered through culture to become more real than real: hyperreal. Conventions such as X-rays are easily understandable as they are common currency within culture: most people have had an x-ray taken at some point. Ultrasound, too, is often shown without 'framing' techniques: although harder to interpret they are in common use, and even if you cannot perceive the image, you are aware that it is of the order 'ultrasound' and therefore shows the inside of the body. (Treichler/Cartwright/Penley, 1998) For more complex sequences, or ones where scale is altered so much as to abstract the image, a technique of penetration was used. If we were about to , say, journey into someone's ear, the camera moves up to the surface of the body until we are seeing it in extreme close-up and magnified, and then dissolves to the internal image. This shot helps to locate the objects being seen in a physical sense: to relate them to the lived body.

The Body and Televisual Presence

There is something about television images that has an immediate and mesmerising effect. It is the relation in the third dimension that gives television images their immediacy, and 'reality'. Two dimensional flat images never provide enough information to be completely absorbing to the viewer. A three dimensional image, however, draws the viewer in by implying their presence as an observer. But televisual images are two dimensional in the same way paintings are: both forms use perspective and chiaroscuro to give the illusion of spatial depth. The order of photography present in the television image also guarantees its authenticity:

'The photographic image is the object itself… it shares by virtue of the process of its becoming, the being of the model of which it is a reproduction. It is the model'

(Andre Bazin, 1967, quoted in Freedland/Wartenburg, 1995)

Television has a closer relationship to the body than cinema due to its physical scale. The confines of the small screen mean the reliance on close ups of faces to enable the viewer to read emotion successfully. These head-and-shoulder shots appear close to life size on the screen, unlike cinemas grossly inflated bodies. Additionally, the framing of television is more obvious due to its smaller size, so bodies tend to be fragmented, cut into by the edges of the screen. Full length shots are rare; it is only by watching the flow of images unfold that the viewer perceives the subject in its entirety. Time is the organising third dimension of television: it is nothing more than a rapid succession of still images: Muybridge written large. Television images achieve a further illusory depth through movement: the camera can move around the object, the object can change in time… the essence of Bahktin's chronotope. (Featherstone/Burrows, 1995) This is all read as the dispersal of the objects in a three dimensional field.

This illusory depth allows the viewer to imaginatively project themselves into the world within the television. Specifically, it is moves along the z-axis perpendicular to the screen which induct the viewer into the 'interior space' of the television. (Morse, 1988)The only time we experience anything like a rapid z-axis move in normal perception is when the body is travelling at great speed and the use of z-axis shifts in cinema and television can induce an unpleasant feeling of motion sickness in their most extreme form. This very unreality helps them act as transitional moves, linking the viewer from one representational idiom to the next, pulling their attention into the programme. They often occur at the beginning of narrative dramas as a long zoom in to the subject, and in station logos that appear to demarcate programmes. An extreme version of the effect of z axis movement is seen in television console games: the player often ducks and flinches as the game unfolds, reacting to the visual data on the screen. In The Human Body, they act to draw us into the space of the represented body, moving seamlessly between scales, and the raw photographic and computer processed images.

We are immensely susceptible to immersion in screen worlds, not least because they offer us a kind of freedom in phantasy. Much has been written regarding the ability of the viewer to identify with the screen image through the gaze, and the narcissistic identification with the figure on screen. The forces at play are those of the Lacanian mirror phase: the moment at which the ego was formed through identification with another, an external image. (Bowie, 1991) The joy of identifying with the screen, of immersing yourself in the image is a purely cognitive one. It is a way of disavowing the fragmented flesh, and entertaining the phantasy of being an omnipotent consciousness: like Dr Tulp, able to influence the world through thought alone. The Cartesian split is resolved by denying one side of the dualism. The troublesome body, with its demands for food, excretion and general maintenance is forgotten: left to 'veg out' on the sofa. The privilege our culture gives to the mind as the seat of identity and individuality means that the body is disavowed: I know I am flesh, but nonetheless…

Disappearing Bodies

So, if we are so desperate to deny our flesh, why do we take pleasure in watching a programme like The Human Body? The answer lies in the way that its images of the body are constructed. In reducing the perceptions of a great number of different senses to vision alone, we are circumscribing the body, and the hence the affect its more unsavoury elements can have on us. The threat of disgust and alienation from an unpleasant smell or sliminess, of discovering that inside the skin that defines us as separate from the world there is nothing but muck and ooze, is prevented by remaining in the apollonian realm of vision. (Paglia, 1992; Kristeva, 1982) The images we see are so carefully constructed, with the 'extraneous detail' cleaned out by computer, that while they purport to be of the real body, they are really of the body as the mind envisages it. They are ideal forms, which do not hover on the edge of abjection, do not threaten the cohesion of identity by suggesting the presence of the other, the alien within the self. By schematising vision we are ordering the world, exerting power over it, bending it to our will. These sanitised images of the body let us indulge in the solipsistic fantasy of the cognitive mind being freed from the flesh through the construction of virtual spaces into which we can project our consciousness. If the body can exist in this perfect codified form within this machine, then I too can think myself inside that perfect body. By escaping the flesh it is possible to escape the ever present spectre of death that hangs over the physical body. It is this fear of death that lends the disgusting some of its uncanny power: in seeing the waste and effluvium of the body we are reminded that we are in flux, ageing, decaying even in the midst of life. We dream of becoming cyborgs to achieve immortality: the virtual body is a total prosthesis of existence. (Featherstone/Burrows, 1995, Morse, 1998)

However, it is all too easy to rupture this romantic projection into the ideal image of the body. There were images in The Human Body that shocked and disgusted. When they appeared, usually only briefly, their affect was startling. The extraordinary sense of power, wonder and omniscience that seeing into the body through digital 'magic' engenders suddenly collapses as a camera is placed inside the body through endoscopy, or when the body is physically opened up and displayed to the naked eye. We are reminded of the biological, physical, material nature of ourselves when we see bile gushing from a duct into the intestines, or a heart beating in an opened chest cavity. (Miller, 1997) The images have an immediate, visceral effect: queasiness, a feeling of discomfiture that makes the viewer fidget, a kinaesthetic disturbance. The repressed body returns to make its presence felt most persuasively.

'The baroque modern acquisition of a heightened visual sensitivity, however, involves both the dominance of sight and the channelling and experiencing of other senses via the activity of looking. [ ] Our mouths may water when seeing something sweet and forbidden, for example, but we can also become sad or angry when watching a movie, or aroused when viewing erotica. So, baroque modern bodies may 'read' and 'decode' images, but they increasingly experience them sensually.'

(Mellor/Shilling, 1997, p 51)

If we consider mind and body to be separate, any sensory perception which results in a sensual, embodied feeling will be experienced as external to some extent, originating in some other place than the cognitive self. Even if visual perception can influence the senses, we still have the uncanny feeling that there is some kind of direct visceral link between that body on the screen and the physical sensations its image is causing in us, unmediated by our mind. The cybernetic, televisual body is governed by feedback: between the media which act as a crude telematic prosthesis, and the conception of self that is ruled by the eye.

The uncanniness of suddenly becoming aware of our bodies while absorbed in watching the television is the indicator of the paradigm shift in the conception of the body. The 'pricking' we feel when the 'real' impinges on our suspension of disbelief is a reminder that we are embodied beings, whose consciousness is deeply affected by the body that forms it. Even in Psychoanalysis' subjective theory of the mind, the primary driving force for mental development is bodily stimulus: whether it be the trapped language of Jouissance or the more visceral pressures of weaning, the body constructs the mind to some degree. The body helps to form our individual 'human-ness' just as much as our mind. The dialogue around evolution and genetics has popularised the idea that humanness is an innate quality of the flesh, with the code of our being reproduced in the billions of discrete cells that work together to make us us. The loss of self into a reverie of mechanical vision, then, raises the spectre of a disembodied consciousness that would cease to be human in some way. If that code were stripped out of the body, and implanted as a kernel of knowledge within a computerised network, what would its 'life' be? Can digital code undergo mitosis?

As we become more accustomed to interfacing with machines in our everyday existence, and as those machines become more responsive to us and provide us with more feedback, we start to invest them with an agency of their own. The hypothetical possibility of a non-human intelligence is getting closer to reality with each new advance in computing. As we see ourselves increasingly in terms of information technology in Wiener's episteme of Cybernetics, the category difference between human and machine is becoming blurred. This blurring of boundaries is a source of disgust and abjection. But what is it about this possibility of disembodiment and absorption into technology that unsettles us?

The most frightening monsters that the end of the millennium has to offer are somatic: the zombie, a body stripped of its mind is no more than flesh, and constantly threatens the 'quick' with pollution and decay; the 'borg, a body consumed by a networked consciousness, losing its individuality as mechanical prostheses penetrate its flesh. (Creed, 1993) They are both violators of cohesiveness, of the impermeable envelope of the skin which demarcates the individual. We do not possess a body, we are a body, a complex interrelation of organic parts that working together in a network produce a discrete being. The Cybernetic episteme, then, finally fuses the mind and body into an inseparable whole, and offers the opportunity to extend this whole through the agency of machines. Our fear is not of absence of mind, but of loss of body, and hence individuality.

As we utilise technologies of telepresence, what happens to our bodies themselves? The simple answer is feedback. They allow us to experience that telepresence, processing the data that comes from 'out there' and adapting accordingly, but give us an anchor point, a way home as they remain rooted in the reality that we must return to. Our bodies ensure we never lose ourselves in the phantasy of the virtual.

Television makes us body-conscious.

Two

Production Analysis

'We've not designed and Aesthetic for the inside of the body any more than we have developed an aesthetic of disease. Most people are disgusted: like when they watch an insect transform itself. But if you develop an aesthetic for it, it ceases to be ugly.'

(David Cronenberg, quoted in Starnbrook 1988 p54)

Artists tend not to come across too well on television. For some reason, they are very easy to mythologise: for every reasoned portrayal there are ten crazy geniuses. I suspect it may be a result of the programme makers' search for a really good narrative: the glamorised exploits of Francis Bacon are bound to be much more interesting to a lay audience than a staid explanation of the use of perspective in renaissance Italy. The popular image of the artist as an heroic, suffering genius living in a messy attic is largely do to the influence of a few films that have indelibly imprinted themselves on the public imagination.[2]

The truth tends more towards artists being rather disciplined people, who are extremely involved in, and articulate about the work they do. It takes a great deal of application and dedication to make a living as an artist, and even the most sensational or apparently shallow Artworld celebrities work within carefully thought out conceptual frameworks.

Art practice is rarely shown as an analytical process that works towards a specific understanding of the world. The current discourse around the body in art has been going on since the mid eighties, and shows few signs of loosing its vitality. It is rooted deeply in post-modern theory and an understanding of grand narratives like that of Psychoanalysis. However, little critical attention had been paid to it on television when I pitched this project. The exception was the series 'Vile Bodies' (Channel 4) which dealt with the body thematically, covering a range of photographers and the unique vision they brought to their subject. The series was interesting in that it not only took a representative cross section of artists, rather than following one artist's development, but also gave the artists space to demonstrate their practise: the working techniques that they apply. The variations in the style of images was incredible, considering they were all working from the same basic raw material. The contrast between a corpulent nude by Jenny Saville, the wild children of Sally Mann and the circus side-show deformities of Joel Peter Witkin only illustrates the breadth of interpretation within this very specific area of investigation. The emphasis is on the process of the construction of representations, the codifying process of image-making. Other programmes since, such as Lucy Blakstad's Naked, and The Human Body have also engaged in this debate about the body, but from different initial positions.

As soon as I decided to make a programme that featured artists I began to think about ways of confounding the expectations we bring to the arts documentary. Having been through the art college system, I have been made very aware of the fact that a lot of being a practising artist is about having a finely tuned self critical faculty, which is applied to everything from the simplest drawing to the way that you conceive the practice of art. There are no givens, but there are a lot of popular 'drifts': loci of ideas that suddenly coalesce into a definable movement. I wanted to get some of this feeling of a groundswell of ideas in the way the programme surrendered its information: in fragments, slowly building up a cohesive picture. In particular the use of the 'commentary boxes' in the opening sequence to deliver soundbites that sketch out the subject was meant to do this. However, on re-watching the piece, I feel that although this works very well, the editing of the rest of the programme was too busy and rapid to give this sense of a slow uncovering. It is a bit more like bombardment with information: a fault of a rushed offline, and my determination to fit my material into a formal structure. Perhaps I should have carried this approach through the whole programme, superimposing the interviewees over other images? The formal 'grid' overlaying the programme was a way of structuring the rather diffuse dialogue, and referencing the idea of 'ordering the world' through looking. It was partly borrowed from the dense graphics of Greenaway, (who has a particularly visceral sensibility towards the body, but does not romanticise it) and in part derived from a pun on the title Drawn and Quartered, which has particularly rich allusions of evisceration, torture and gore, but can also be read as organisation through drawing.

I also felt that I wanted to show artists at work, and get them to articulate what processes go on in the space of Drawing. It is so often thought of as a way of fixing an image of the world that it is easy to overlook the fact that it is also an investigation: a way of finding out about an object through observation, and translation onto the page. Drawing is much more of a process than an end product, as much about the co-ordination of body movements to the movements of the eye as the image produced. Sarah Simblett illustrated this brilliantly in the way she talked about relating the lines she draws to what she knows about structure and dissection. She was extremely halting during face to face interviews, but became much more articulate about the practical aspects of drawing when we filmed her 'working'. I would seriously consider using distraction as a way of getting more out of an interviewee in future: it seems to overcome a certain self-consciousness by absorbing whichever bit of the mind is preoccupied with worrying about the camera! The students also articulated their involvement with drawing better when referring to a visual prompt.

The conventional Arts documentary tends to profile artists or movements. By taking a subject matter as a starting point rather than a biographical approach, the breadth of contributions and the de-emphasis of hagiography mean you end up with a privileging of ideas rather than the aura of the artist: the quality of the work is what makes it special, not the fame of the author. My final decision to make a programme about the relationship of artists to Human Anatomy was affected by the prosecution of an artist for stealing body parts from a medical school morgue in order to cast them in metal. The case created enough controversy to be discussed in a special feature on the Channel Four News. However, much of the debate in the media was around the questionable status of the objects as Art objects (and hence of his legitimacy as an artist), and the morality of what was seen as a kind of grave robbing, rather than a questioning of why an artist would be interested in working with such gruesome subject matter. What was he trying to communicate about the body parts? What was he learning by making this work? After all, we are quite happy to regard the dead body of a shark as sculpture, but what is so problematic about casts from dissection lab specimens?

Having studied anatomical drawing at college (something that many of my contemporaries disliked more because it was an irrelevant chore rather than a sickening manifestation of ghoulishness) I feel privileged to have been able to face the human body in death in a calm atmosphere of enquiry. It was exactly this sense of respect and uncanny fascination felt in the dissection room that I was interested in expressing in a programme. Being able to visualise the inside of your body as muscle and bone alters your perception of it. As one of my interviewees said,

'Its odd when you have a pain, and you can think about it and know exactly what it is that's hurting'.

Odd is the right word: it isn't frightening or repulsive, merely a bit… strange to know how something that as part of yourself you take completely for granted works. Jessica's articulation of her new understanding of the solidity of her body is a particularly lovely illustration of the way access to this knowledge can change your psycho-physical being. However, this calm understanding of the fragility of the anatomical body is probably not shared by the general viewing public. I suspect that for the general viewer, the subject matter would be seen as 'Sensationalist' and slightly sick, but fascinating: the non-arts viewer is watching in the prurient hope of seeing something gory for a bit of excitement.

There is a specific kind of hysteria surrounding the practice of Anatomy. It is more than simple disgust at the idea of close contact with a corpse, and more than a mistrust of what they could do to your body were they ever to get hold of it. There is a strong taboo around opening up the human body and investigating the stuff that is usually hidden from view. I suspect it is to do with the actual disruption of the envelope of the skin. A BBC Policy study conducted in 1976 about reactions to medical programmes on television found that 58% of those surveyed would feel squeamish about seeing surgical operations, and of the things they would feel squeamish about in a television documentary about medical topics, the first cut of the surgeon's knife came top, also with 58%. Quite aside from exposing the formless and repulsive mass of internal organs to the eye, cutting into the skin is also a way of negating someone's individuality. In life it was what made them discrete from the world at large, and in death it holds in the decaying, corrupt interior. Even in the hardened, preserved corpse there is a sense that the body is the container of all kinds of unspeakable ooze. It would be very easy for the subject matter of this programme to be utterly grotesque, and hence alienate its audience. As far as I am concerned, the only images that come close to this in the finished product are the zoom from the wax head, which shocks because of the unexpectedness of the disruption of the form, and the two stills of a dissected corpse taken from a textbook. These were very carefully placed during the description of the sessions in the dissecting room, with the profoundly reassuring Doctor Wood leading into them to explain the experience of looking at a dissected corpse in a very matter of fact way .

The challenge in making a programme which deals with corpses is very simple: legality. The taboos surrounding the 'violation' of the human body are so strong that access to the dissection room is under the direct control of the home office, and any form of image-making other than drawing has to be specifically licensed and be for teching purposes only. So, from the start I was setting out to make a documentary in which the subject would be invisible. However, I think this is an interesting position to be working from, as it reflects the invisibility of the anatomical body in everyday life. If you have taken the time to learn about the physical structure of the body you can read it into the bodies you see every day: the knowledge overlays the reality of vision. In the case of the documentary, the student's very different approaches to drawing from the model show how each of them is projecting their understanding onto the form of her body. I wish, in retrospect, that I had included more of the 'illustrated man' sequence that appears in two of the montage sequences. I felt that the piece needed more illustrations than just the drawings and the medical models, and looked for a way of describing anatomical data directly on to the body. I toyed with ideas of projecting slides onto a model, and also of using carefully set up dissolves to overlay drawings onto 'real' images. The solution I came up with - of drawing onto the skin with a wax based pastel - had an immediacy that the other methods lacked (it worked in three dimensions) and ended up looking much better than I imagined. Of all of the images in the programme, this is the one that has attracted the most attention (I have even been advised by a doctor to patent the technique as a teaching method�), although it is onscreen for less than six seconds!

Practicalities

The initial pitch for the programme, submitted in April, shows very much the same intentions as the final piece, but has a rough structure and contributor list very different from the finished programme. At the time the recent Noel-Kelly case meant that there was a great deal of 'buzz' about the subject, and I wanted to include as much information as I possibly could. It was nice to imagine that I might try to get an interview with Peter Greenaway, but… Looking back at this first outline it is apparent how much more focused on the subject I became during the production process. It is also somewhat surprising, as I always feel that focusing isn't something I am particularly good at when I have an interest in a subject.

The main reason the programme changed so radically from this first pitch was the fact that John Carter had left the Ruskin School. Although this didn't exclude his use in the final product, it transpired that there was a legal battle pending between John and the school, and consequently they were not in a position to give me his contact details. As I felt he was vital in the structure of the programme I had to sit down and rethink the flow of the piece.

I chose to take a recce trip to the school to discuss the possibility of the project with them in early May. Although I know the Ruskin very well, having studied there, I felt that persuading the staff to let me disrupt their examination would be easier face to face than by letter or telephone. As it was, this trip was tremendously helpful. As John's departure meant a restructuring of the course, anatomy had taken off in a big way in the previous year. I found out that the school had organised an exhibition of students' work at Brantwood, (John Ruskin's house) in the Cumbria, and consequently I organised a minimal two-man shoot to get footage of the private view. The historical connection of John Ruskin also seemed to be a good linking mechanism, as he was utterly opposed to the teaching of anatomy in art schools, and the irony of the organisation of an exhibition of anatomical drawings by students from the art school he founded in his old studio-come-billiards room would have been a nice point of departure for the programme. Sadly, the gallery was a very poor shooting location, and the American academic who addressed a crowd of eccentric Ruskin enthusiasts did not come across very well. The only footage eventually used from this trip were some cutaways; the most expensive shots to achieve! It did, however, introduce me to Sarah Simblett who proved to be one of the most important contributor to the programme.

I was managed to negotiate access to shoot in a mock anatomy examination: a single days' shoot in Oxford. Again, being an ex-student helped in that I knew Karen, the life model, fairly well which made persuading her to appear naked on camera much easier. This, strangely, is not as big an issue as it seems, as you become accustomed to the students treating you with absolute indifference: all they are seeing is an object to draw, not a naked person. All of the students signed disclaimer forms, and we took great care to be undisruptive: filming for the first twenty minutes of each half of the exam only. Distributing free cigarettes during the break also helped! It was slightly harder to persuade them to talk individually to camera, especially as by then we were filming in a busy, and very noisy stairway. The whole thing was filmed without proper lighting, as the distribution boxes developed a fault. I feel that this did adversley affect the image quality: the studio shots tend to be very contrasty due to the large windows, and the interviews look very underlit.

The main shoot was much more focused thanks to the somewhat unsuccessful Cumbria trip. I had time to decide that I would concentrate on the student's experience of learning anatomy at the Ruskin, and why anatomy is still relevant today. Sarah Simblett, who teaches life drawing, contextualised it in terms of the broader practice of the artist, and Professor Petherbridge (who I read about in the Independent on Sunday and contacted through the Royal College of Art) gave it a historical background that situates it in tradition: important considering that very few colleges still teach anatomy, and it is considered old-fashioned by many. Dr Wood gave an outsiders viewpoint: although he has an interest in art he is a research histologist, and answered many of my stock questions (What is it that people find upsetting about the dissected body? What can students learn from anatomy? and so on) from a very different point of view. He was the hardest person to edit into the final programme, because of the circuitousness of his answers compounded with the poor camera work during the interview. The location for the interview was a turn of the century lecture theatre lit with a single redhead, giving certainly the best quality of image and sound of all the interview sequences.

The shoot at the RCA was difficult in terms of location again. We were given the option of a tiny office, or a studio, which turned out to have a persistent fan in the background, and to be under a flightpath. The light was also very changeable. PPS cleaned the great part of the hum from the soundtrack, but has left the Professor's voice very muffled. Similar problems occurred whilst filming Sarah Simblett. As art studios tend to have plain, unbroken concrete walls and high ceilings, sound bounces a great deal, making background noise more of a problem. Lighting is also hard, as you end up with a very flat light, ideal for drawing but not for betacam.

The cutaways that are not student's or Sarah's drawings are mainly sourced from Professor Petherbridge's book, 'The Quick and the Dead' (1998). Much of the copyright in them is attributable to the Welcome Collection. Sources inform me that I can expect to pay approximately £50 an image for use in a non-profit making student film. Professional costs are variable, but could range to thousands of pounds per image. The other source of cutaways was the Internet: the two small 'Virtual Human' animations are shot directly from a computer screen. Purchasing the copyright for these would involve buying the digital human database rights, and then using the information to compile 3-D models.

The post production process was relatively simple, if a bit fraught. As all of my interviewees were knowledgeable and articulate my main problem was deciding which quotes to keep, a process only possible by writing full transcriptions of the interviews. The depth of the material meant that it was very easy express my viewpoint through a distillation of the interviewees quotes. Whilst this sounds like very cynical manipulation, as I come from the same background as most of my contributors, they articulated the ideas I was interested in with very little prompting. I had a slight moral problem as to whether to cut out Brian Catling's stammer at this stage. However, the whole image of the stuttering man in dark glasses is part of his public persona as a performance artist, and I feel he may have been offended had I done so. As it is, he seems to stutter on particularly pertinent words, and the listener's anticipation helps to stress important points.

I have mentioned the reasons I chose to use such a definite structure to the piece previously. The picture in picture approach replaced the proposed time lapse sequence of John's drawing. I like the effect, but feel that cutting it on the fly probably wasn't the best possible solution. As my music was not delivered in time to use it at the offline stage, much of the cutting I would usually do to the beat was left to chance. The music itself was changed from that originally written. The first themes were much heavier, with a bombastic, hammer horror feel to them which changed the feel of the piece completely. Whilst I am still not entirely happy with the music, it was a case of changing it at the last minute: the mistake was entirely due to a subjective misunderstanding of 'Phillip Glass'.

Whilst I find it embarrassing to watch the programme back now, I know that I have articulated the ideas I set out in my pitch, and achieved the best possible quality given my circumstances. My main error lies in the furious pace, which I really was not aware of during the editing process. I think that overfamiliarity with the material leads to difficulties in judging pace. My stubborn insistence to limiting myself to 12'30" also meant that I was trying to fit too much information into too short a programme. In retrospect, I am not sure of the wisdom of tackling subject matter that is so close to my own experience, as it is very easy to get carried away by other peoples enthusiasm at times. However, I feel that I managed to keep an objective viewpoint. The only problem is that my enthusiasm for a subject close to my heart is no particular guarantee that an audience will find it engaging.

Three

Bibliography

Boddy, William 'Archaeologies of Electronic Vision and the Gendered Spectator' in Screen 35 (2) Summer 1994 pp.105- 122

Bowie, Malcolm (1991) Lacan London, Fontana Press

Cartwright, Lisa (1995) Screening the Body: Tracing Medicine's Visual Culture Minneapolis, University of Minnesota Press

Creed, Barbara (1993) The Monstrous Feminine: Film, Feminism and Psychoanalysis London, Routledge

Cubitt, Sean 'Review: Anne Balsamo, Claudia Springer, J.P. Telotte�' in Screen 38 (3) Autumn 1997 pp. 296-301

Curran, James and Gurevich, Michael eds. (1991) Mass Media and Society London, Edward Arnold

Dawkins, Richard 1989 The Selfish Gene Oxford, Oxford

Eleftheriotis, Dimitris 'Video Poetics: Technology, Aesthetics and Politics in Screen 36 (2) Summer 1995 pp. 100-112

Ellis, John (1982, Rev. 1992) Visible Fictions: Cinema, Television, Video London, Routledge

Featherstone, Mike; Hepworth, Mike and Turner, Bryan S. eds. (1991) The Body: Social Process and Cultural Theory London, Sage Publications

Featherstone, Mike and Burrows, Roger eds. (1995) Cyberspace, Cyberbodies, Cyberpunk: Cultures of Technological Embodiment London, Sage Publications

Fiske, John (1989) Television Culture London, Routledge

Foucault, Michel (1970) The Order of Things: An Archaeology of the Human Sciences London, Tavistock

Foucault, Michel (1973) The Birth of the Clinic: an Archaeology of Medical Perception London, Pantheon

Freedland, Cynthia A. and Wartenburg, Thomas E. eds. (1995) Philosophy and Film London/New York, Routledge

Freud, Sigmund (1991) Penguin Freud Library 7: Three Essays on Sexuality and Other Works London, Penguin

Horrocks, Chris and Jevtic, Zoran (1997) Foucault for Beginners Cambridge, Icon

Kristeva, Julia (1982) Powers of Horror: An Essay on Abjection New York, Columbia University Press

Kroker, Arthur and Kroker, Marilouise (1987) Body Invaders: Panic Sex in America Montreal, New World Perspectives

Leader, Darian and Groves, Judy (1995) Lacan for Beginners Cambridge, Icon

Mellor, Phillip and Shilling, Chris (1997) Re-forming the Body: Religion, Community and Modernity London, Sage Publications

Miller, William Ian (1997) The Anatomy of Disgust London, Harvard University Press

Morse, Margaret (1998) Virtualities: Television, Media Art and Cyberculture Bloomington, Indiana University Press

Paglia, Camille (1992) Sexual Personae: Art and Decadence from Neffertiti to Emily Dickinson London, Penguin

Pangaro, Paul (Retrieved 05/01/99) Cybernetics: a Definition @ http://www.pangaro.com/~pangaro/published/cyber-macmillan.html (Retrieved 05/03/2008 from http://www.pangaro.com/published/cyber-macmillan.html)

Petherbridge, Deanna and Jordanova, Ludmilla (1998) The Quick and the Dead: Artists and Anatomy London, National Touring Exhibitions

Sawday, Jonathan (1996) The Body Emblazoned: Dissection and the Human Body in Renaissance Culture Routledge, London

Shaviro, Steven (1993) The Cinematic Body Minneapolis, University of Minnesota Press

Showalter, Elaine (1998) Hystories London, Picador

Starnbrook, Alan 'Cronenberg's Creative Cancers' Sight and Sound 58 (1) Winter 1988/9 pp54-6

Taylor, Mark C. and Saarinen, Esa (1994) Imagologies: Media Philosophy London, Routledge

Thacker, Eugene (Retrieved 16/11/98) …/visible_human.html/digital anatomy and the hyper-texted body in CTHEORY @ http://www.ctheory.com/a60.html, (Retrieved 05/03/2008 from http://www.ctheory.net/articles.aspx?id=103)

Treichler, Paula; Cartwright, Lisa and Penley, Constance, eds. (1998) The Visible woman: Imaging Technologies, Gender and Science New York, NYU

Study for the BBC General Advisory Council (November 1976) The BBC's Medical Programmes and their Effects on a Lay Audience (Unatributed)

'The Greatest Story Ever Told' in Ariel 19/5/98 pp. 8-9

The Human Body Series Producer Richard Dale, BBC/Discovery Channel Co-production, 1998

Naked BBC Produced and Directed by Lucy Blakstad, 1998

Vile Bodies Channel 4 / Blast productions, 1998

Appendix

Production Documentation

[In its printed form, this document contained copies of production paperwork created during the shoot of the documentary. They only exist in hard copy form, and add little of interest]

Footnotes